SKU: LSV-0024. Ribonuclease (RNase) III enzyme which processes dsRNAs into 2025 bp siRNAs leaving a 2 nt overhangs at the 3 end. In scrambled shRNA cells, ANF elicited an increase in cGMP production in a concentration- (Fig. WebMock control. ( How to cite ) Sequence Information Sequences (2) Ordering If inadequate or no knockdown is observed, RNA levels can be measured to ensure that effective knockdown of the target mRNA was achieved. Palo Alto, CA 94303. shRNA for use as a negative control. WebThermo Fisher control scrambled shrna scr Control Scrambled Shrna Scr, supplied by Meng, P, et al. Image: Illustrated plasmid map in PNG format. siRNAs are transiently expressed in cells, while shRNAs can be stably integrated through virus-mediated transduction. (2021) NLRC4 activation needs lncRNA LNCGM1082. Here, we injected the AAV2 expressing the shRNA against the receptor (or sh scrambled as a control) in one eye of 3 week-old Pten fl/fl SOCS3 fl/fl mice (Fig. GAPDH (with no target protein siRNA) to The original pLKO.1-TRC cloning vector has a 1.9kb stuffer that is released by digestion with AgeI and EcoRI. After detection with a specific antibody, the levels of protein in the RNAi-treated cells can be compared to the controls and knockdown efficiency can be determined. or SnapGene Viewer. To be certain that your variant of interest is targeted, please contact. Have questions about your order, deposit, or a plasmid? This appears to determine the stable association between the RISC and the target mRNA. This active siRNA is then loaded onto the RISC complex. Sci Signal. However, the efficacy of each approach is dependent on the system. siRNAs, and sometimes an shRNA encoded on a plasmid, are usually introduced to cells using these methods. Addgene is a nonprofit repository for plasmids and offers a wide variety of lentiviral and retroviral transfer vectors [43, 44]. While both of these types of control sequences will be incorporated into Dicer and activate the RNAi pathway, it is possible that the scrambled control may target an unintended mRNA. Wang, Q, et al. The focus of this review will be how shRNAs and siRNAs lead to protein knockdown. Generate cell lines with stable, heritable gene silencing to develop a throrough understand of the target genes function. The target specificity that siRNAs and shRNAs provide has made them promising in medical applications as both therapeutic and diagnostic tools. (2021) Knockdown of LINC01385 inhibits osteoarthritis progression by modulating the microRNA-140-3p/TLR4 axis. Systems, Research 2017;8:e2926. Does Addgene accept orders by fax, phone or email? ; Precut pCAS-Guide cloning kit (10 RXNs), GE100007 and GE100008 included. Also converts siRNA sequences into shRNA sequences. Controls for shRNA Adenovirus For shRNA adenovirus, we highly recommnend using a scramble shRNA adenovirus as the control. Lipid Transfection. & ORFs. Please acknowledge the There are also synthetic shRNAs available which, unlike the viral vector-delivered molecules, can be chemically modified to affect their activity and stability as described above for siRNA molecules. Mouse Myc shRNA Lentivirus $ 595.00 $ 1,195.00 Select options Validated shRNA Lentivirus Key Advantages: Same Cost For Custom Lentivirus - You can receive any combination of reporter Read more Human MYC shRNA Lentivirus $ 595.00 $ 1,195.00 shRNA Scrambled Control-LVRU6MH Lentiviral Particles (25 l x 4 vials) Purified: 10 8 TU/ml,100 l, purified, transduction-ready particles: U6: mCherry/Hygro: psi-LVRU6MH: LP522-025: shRNA Scrambled Control-LVRU6MP Lentiviral Particles (25 l x 1 vial) Purified: 10 8 TU/ml,25 l, purified, transduction-ready particles: U6: document your everyday molecular biology procedures. Adenoviruses expressing shRNA for silencing of human TSPAN7 (Ad-ShTSPAN7, SKU# shADV-226,651) or scrambled shRNA control (Ad-Scramble, SKU# 1122) together with eGFP under a CMV promoter were purchased from Vector Biolabs. Depending on your shRNA your cells might start to compensate by increasing or reducing the expression of other signaling proteins which will affect your signaling assays. To be certain that your variant of interest is targeted, please contact. encodes of a scrambled shRNA sequence that will not lead to the specific degradation of any cellular message. Good for use on difficult to transfect cells. Infect most cell types. without restriction by academic, nonprofit, and governmental entities, except that the A Cells were lentivirally transduced with either scrambled sequence (control) or FAP shRNA for 4 days followed by CCK-8 assay to determine cell viability. Long dsRNAs cause strong induction of the innate immune response, similar to what is observed during viral infection, leading to global mRNA degradation. Lee J et al transfected iPSC-derived cardiomyocytes with either scramble siRNA or siRNA against PDGFRB using it [30]. This website uses cookies to improve your user experience. Use code "Cell88". WebScrambled shRNA control in pGFP-C-shLenti shRNA Vector TR30021 | OriGene Non biologists to create, browse, and share richly annotated sequence files. Transduced cells can also be isolated using FACS. DNA delivered using adenovirus-derived vectors are maintained as epichromosomes in the nucleus, making the expression transient, but eliminating the risk of insertional mutations. Copyright 2022 OriGene Technologies, Inc. All Rights Reserved. Lee YR et al used MilliporeSigma siRNA duplexes and Dharmacon lentivirus-based shRNA constructs to target WWP1 gene and Dharmacon SMARTpool siRNA to target MYC [39]. Some cells do not tolerate transfection and they may not be susceptible for delivery by viral vectors. There are many lentiviral and retroviral plasmids that are suitable for shRNA expression (see Products Section below). It is specific and non-toxic. The vector also co-expresses puromycin and copGFP from the moderate EF1 promoter, with co-expression mediated by a T2A element. Sequence of hairpin is:CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG. This, in turn, blocks further expression/accumulation of the proteins, leading to a decrease in its levels, and eventual knockdown. siRNA sequences between 1929 nt are generally the most effective. (2022) STAG2 expression is associated with adverse survival outcomes and regulates cell phenotype in muscle-invasive bladder cancer. Available from: De Cecco M, Ito T, Petrashen A, Elias A, Skvir N, Criscione S, Yu X, Liang Q, Liu W, Zhou L, Li W, Liu H. Deguelin, an Aurora B Kinase Inhibitor, Exhibits Potent Anti-Tumor Effect in Human Esophageal Squamous Cell Carcinoma. Chakraborty AA et al obtained pLKO-based shRNA plasmids targeting Kdm6a and Kdm6b from GPP, Broad Institute [38]. Conditional shRNA expression under the Cre-Lox control. dsRNA with 2 nt 3 end overhangs that activate RNAi, leading to the degradation of mRNAs in a sequence-specific manner dependent upon complementary binding of the target mRNA. Fields, Pathways If you are interested in contributing a manuscript or suggesting a topic, please leave us. Robinson, AD, et al. As was observed in vitro, there is still a concern that activation of the immune response upon introduction of dsRNA may exhibit excessive toxicity and inhibit effectiveness. The minimal RNA-induced silencing complex (RISC) consists of the Argonaute protein and an associated siRNA. Nuclear hnRNPA2B1 initiates and amplifies the innate immune response to DNA viruses. Xin, R, et al. For shRNAs other important controls include an empty vector control, which contains no shRNA insert, allowing for the determination of the effects of transfection/transduction on gene expression and the response of the cell. Lipofectamine 3000, to A498 cells [32]. JavaScript seems to be disabled in your browser. K, Survival analysis of cases treated with shSC or shAnxa1. They also noted that the RISC is not capable of unfolding RNAs. Luc-Fluorescent Imaging Lentiviral Particles, Non-Lentiviral ORF cDNA Expression Plasmids, Custom LentiCRISPR sgRNA Lentiviral Particles, Custom Gene Promoter Lentiviral Particles, custom shRNA lentiviral particles request form. Ye, Q, et al. Using SBIs shRNA lentivectorsselecting for transductants. For a more detailed description, please see Recombinant Adenoviral Vector Systems. Many labs have published strategies for the creation of long dsRNAs for transfection experiments. A comprehensive review of siRNAs and shRNAs as tools for gene silencing. What strain of bacteria does my stab contain? Zhou R et al obtained the adenovirus expressing CHC shRNA from SignaGen Laboratories and those expressing TrkB, FGFR1 or calpain-2 shRNA from Vector BioLabs [35]. shRNA design tool that allows you to choose between three loop sequences or enter a custom sequence, as well as specify restriction sites for the 5 and 3 ends, designate GC content, and length. Please note that the 5' cloning site, AgeI, is typically destroyed during the shRNA cloning. Deming et al obtained MS4A4A shRNA pGFP-C-shLenti (TL303135B) and the control hRNA pGFP-C-shLenti Scrambled (TR30021) from OriGene to transduce cultured monocyte-derived macrophages [37]. Use with SnapGene software or the free Viewer to visualize additional data and align other sequences. The positive surface charge of the liposomes formed by Lipofectamine/RNA mixtures allows for the fusion of liposome/nucleic acid complexes with the negatively charged cell. Browse our catalog of pre-made lentivirus packaged with validated shRNA for popular genes. shRNA oligos are cloned into the AgeI and EcoRI sites in place of the stuffer. $ 395.00. These controls activate the RNAi machinery and allow baseline determination of the effect of the introduction of duplex RNA on gene expression. Depending on the specific shRNA sequence, the site can occasionally be restored. Use text editor or plasmid mapping software to view sequence. Capable of handling large (8 kb) inserts. Scramble shRNA control is the real negative Zhang, R, et al. This creates a new dsRNA, which is then processed by Dicer, creating a positive feedback loop that increases the pool of siRNAs. TERMS AND CONDITIONS OF SALEPRIVACY STATEMENT, Streamline your shRNA studies with this ready-to-go non-targeting, scramble hairpin shRNA expression vector co-expresses puromycin and copGFP from EF1. (2022) Endothelial cells regulated by RNF20 orchestrate the proliferation and differentiation of neural precursor cells during embryonic development. Kitchen P et al used pGFP-C-shLenti-AQP4 and pGFP-C-shLenti-Control from OriGene to infect dorsal column neurons in rats [36]. shRNAs are transcribed by either RNA polymerase II or III, depending on the promoter driving their expression. Saito T et al transfected HepG2 cells with SMARTpool siRNAs using Dharmafect 1 from Thermo Fisher [28]. Lipofectamine 2000 was used to transfect, for example, into HEK293T cells [14, 32] or Hela [32]. This process is illustrated in Figure 2. It also provides many ready-made shRNA plasmids such as pLKO-RB1-shRNA63 and pLKO-RB1-shRNA19 from T. Waldman (Addgene plasmids 25641 and 25640) [45]. AAV2 is the typical serotype used to make recombinant AAV vectors. Offers shRNAs as bacterial glycerol stocks, plasmid DNA, or lentiviral particles, Offers shRNAs as lentiviruses, among others, Pooled libraries for hiigh-throughput screening, Dependent on cell type, health, and confluency, as well as DNA quantity. A non-targeting control, on the other hand, is an siRNA/shRNA sequence designed such that it does not target any known genes in the target organism. Epub 2020 Feb 3. Dotted line represents uninfected Jurkat cells. MilliporeSigma offers sets of 3 siRNA duplexes targeting a specific mouse or human gene, with a guarantee that 2 will provide knockdown efficiency of at least 75%. TurboFectin Transfection Reagent (1 mL in 1 vial), DH5 Chemically Competent Cells (10^8 cfu/g of pUC19 DNA). WebGenerate a negative control for siRNA/shRNA. Ideal sites to target include AA dinucleotides and the 19 nt 3 of them in the target mRNA sequence. The effects of blood flow recovery in the QKI-7 knockdown group were Analysis Tools After transfection, cells stably expressing the control shRNA may be isolated via puromycin selection. AgeI is present in this plasmid. Many companies also offer shRNA expression plasmids as well as shRNA-expressing viral vector systems (Table 6). Figure 1 : Map of pLKO.1 containing an shRNA insert. Copyright 2022 OriGene Technologies, Inc. All Rights Reserved. Engineered to infect human cells, so they should be handled with care. Please note that the 5' cloning site, AgeI, is typically destroyed during the shRNA cloning. Recombinant adenoviruses have had several genes essential for replication deleted, allowing for replication and propagation only in complementing packaging cells (293 cells). However, these modifications can also reduce their gene silencing ability. As early as 1984, it was observed that anti-sense RNA was capable of inhibiting gene expression. Through the activity of several proteins (discussed below), targeting of a cellular mRNA by short, anti-sense nucleic acids (siRNAs and shRNAs) results in its subsequent degradation. Adenoviruses are small dsDNA viruses that infect most cell types. shRNAs are synthesized in the nucleus of transfected/transduced cells and form hairpin structures that consist of a stem region of paired antisense and sense strands connected by unpaired nucleotides that make up a loop (Figure 1b and 1c). Huang H et al purchased from Dharmacon shRNA lentiviral vectors against SETD2, METTL3, METTL14, WTAP, Mettl14 and the control (shCtrl) to knockdown their expressions in mouse embryonic stem cells, HeLa and/or HepG2 cells [32]. Using SBIs shRNA lentivectors. A few of them are included in Table 2. RefSeq: NM_004048, NM_004048.1, NM_004048.2, BC032589 constructs 72 hrs post transfection. While there are a few reports of siRNAs being translocated to the nucleus upon transfection into cells, it is more generally accepted that they accumulate in the cytoplasm. Bioz Stars score: 86/100, based on 8 PubMed citations. 2020 Apr 2;78 (1):70-84.e6. Kim J, Lee J, Hwang H, Lee D, Park C, Jung S. Gandin V, Masvidal L, Cargnello M, Gyenis L, McLaughlan S, Cai Y, Nucleic Acid Delivery: Lentiviral and Retroviral Vectors, link.springer.com/chapter/10.1007%2F978-90-481-3415-1_5/fulltext.html, transfection reagent Lipofectamine/Fugene/Superfect and others, Immunological Analysis of Chromatin and Epigenetic Modifications. They include the dsRNA targeting the target gene(s) (either siRNA or shRNA), Dicer, the Argonaute family of proteins (specifically Ago-2), Drosha, RISC, TRBP, and PACT. Every shRNA construct we make is validated to meet or exceed 70% knockdown of the gene of interest. Patisirant is a double-stranded siRNA against both wild-type and mutant transthyretin. In addition to those discussed below, Batie M et al transfected Hela cells using INTERFERin from Polyplus-transfection with siRNAs purchased from MWG [26]. Generate matching shRNA designs for a transcript sequence Informational Resources and Downloads Protocols Protocols including clone, DNA, and virus production Library Resources Clone inventory downloads Pooled Screening File Downloads For file downloads for analysis of pooled screens, see our Clone Pool section. Additionally, despite being promising as a viral vector, there are still gaps in our understanding of the AAV life cycle. Sequences should have a G/C content between 3555%. Clinical trials are underway for the treatment of macular degeneration, diabetic retinopathy, and hepatitis C. However, there are still obstacles that need to be overcome. Customer Control Scrambled Shrna, supplied by Thermo Fisher, used in various techniques. Moreover, it will have no match with Briefly, control and knockdown cells are collected and the RNA is harvested, reverse transcribed, and quantified or normalized to an internal control (such as GAPDH). An interesting feature of this system in some organisms is that annealing of the siRNA to the target mRNA allows the siRNA to act as a primer, while the target mRNA acts as a template for an RNA-dependent RNA-polymerase. We recently shut down crispr.mit.edu, but there are many other guide design tools available that we hope you will find helpful. Neural progenitors isolated from (N)/tv-a;Ink4a/Arf / pups at P0 as previously described were infected with RCAS-PDGFB-shSCR (scrambled control) or RCAS-PDGFB-shRNA against TrkB.T1, using an RCAS-TVA system as has been described previously described (41, 69). ZERO BIAS - scores, article reviews, protocol conditions and This tool generates a negative control for siRNA : It accepts a short DNA sequence, and returns a scrambled sequence. WebScramble siRNA This tool generates a negative control for siRNA : It accepts a short As little as a 7 nt complementation is capable of producing off-target suppression and is dependent upon the sequence context surrounding the complementary region, the position of the sequence in the mRNA, and the copy number of the sequence within the mRNA. Needed for dsRNA cleavage by Dicer and subsequent passage to the RISC. SIB - Swiss Institute of Bioinformatics; CPR - Novo Nordisk Foundation Center Protein Research; EMBL - European Molecular Biology Laboratory GSE24844: LSD1/KDM1 regulates the balance between self-renewal and differentiation in human embryonic stem cells. Non-effective 29-mer Scrambled shRNA Cassette in pGFP-C-shLenti Vector, 5 ug. The maps, notes, and Among the most common nucleic acid delivery methods are transfection and electroporation. Non-effective 29-mer Scrambled shRNA Cassette in p-RFP-CB-shLenti Vector, 5 ug Learn more, Please note: Your browser does not fully support some of the features used on Addgene's website. In addition to genetic disorders, RNAi is being tested in potential therapies for viral infection. Discover the most Bind 2135 nt RNAs including miRNAs and siRNAs, and their associated target mRNA and then cleaves them through its endonucleolytic function. WebTransfection grade purified shRNA plasmid carrying a 29-mer scrambled sequence (2021) Small extracellular vesicles ameliorate peripheral neuropathy and enhance chemotherapy of oxaliplatin on ovarian cancer. SnapGene Viewer is free software that allows molecular Special Discount: 20% off this product. Adenovirus vectors exhibit extremely broad cell tropism and are safe to work with in laboratory settings. The scrambled sequence will have the same nucleotide composition as the input sequence and it will have passed siRNA filtering for the standard search (see Selection Criteria for more details). Wang L et al used the same INTERFERin to transfect RAW264.7 cells [27]. Available options. 2017;26:100-111, Maiti S, Mondal S, Satyavarapu E, Mandal C. mTORC2 regulates hedgehog pathway activity by promoting stability to Gli2 protein and its nuclear translocation. While this is advantageous for experiments in tissue culture, these vectors pose problems in clinical settings. This involves conjugation of the siRNA with a hydrophobic moiety (e.g., cholesterol) or a cationic CCP (e.g., transportin or pentatratin), which promotes delivery into the target cells. There is a problem with the plasmid I received. Purpose Scrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG) Depositing Lab Anthony Leung Publication Fischer et al Mol Cell. An important factor in choosing between siRNA- and shRNA-mediated gene silencing methods is the length of both the assay and the half-life of the target protein. Reviews. How do I prepare and deposit my plasmids? (2022) LncRNA SNHG1 promotes sepsis-induced myocardial injury by inhibiting Bcl-2 expression via DNMT1. Learn more, Download our file to copy and paste plasmid data, Open collection of AAV data generously shared by scientists, Basic analysis for a user-entered sequence; includes restriction sites and map, Digital collection of empty plasmid backbones from publications and commercially available sources. (2022) Endogenous retroviral proteins as potential drug targets for merlin-deficient tumours. Furthermore, we infected control and APOE, IFITM3, and MX1 shRNA KD A549 cells with A/Puerto Rico/8/1934, H1N1 (PR8). . Non-effective 29-mer Scrambled shRNA Cassette in pB-RS Vector, 5 ug. doi: 10.1016/j.molcel.2020.01.021. Protein levels must be assessed to determine the degree and kinetics of knockdown. WebshRNA Design: These shRNA constructs were designed against multiple splice variants Loop sequences of 3 to 9 nt in length have been shown to be effective. Using SBIs shRNA lentivectors to produce siRNAs. ZERO BIAS - scores, article reviews, protocol conditions and more Nat Rev Mol Cell Biol. siRNAshRNAmiRNA 3shRNAmiRNAshRNAsiRNAshRNADicersiRNAsiRNAmiRNA The cleaved products are then incorporated into the RISC, which is composed of Argonaute-2 (Ago-2), Dicer, and TAR-RNA-binding protein (TRBP). These shRNA constructs were designed against multiple splice variants at this gene locus. Allows you to choose the region the siRNA targets (5 or 3 UTR or ORF), G/C percentage, and if you want to BLAST search the sequence. We then stained the cells with anti-hemagglutinin (anti-HA), anti-nucleoprotein when compared to cells transduced with scrambled shRNA as detected by flow cytometry (fig. As such, care should be taken in designing the scramble sequence to make sure it follows the guidelines mentioned above, and does not target another mRNA sequence. If you require a modification to one of our products (for example, change in reporter or other vector component), please request a custom order. Liao, Y, et al. Also, siRNAs may undergo degradation in the cytoplasm, leading to off-target effects. Sequences longer than 30 nt can result in nonspecific silencing. Butler AA et al injected Lincode SMARTpool siRNAs conjugated with in vivo-jetPEI into mouse hippocampal areas to evaluate the role of lncRNA Neat1 in memory formation [24]. Vector Sequence. Webscramble control for every gene-specific siRNA that is used, therefore a universal Non ), there are also many commercially formulated kits that are optimized for the transfection of certain cell types (such as Amaxa Human Monocyte Nucleofactor Kit from Lonza [10], the Silencer(R) siRNA Transfection II Kit by Invitrogen/Ambion or specifically for in vivo - for example, in vivo-jetPEI from Polyplus-transfection [24] or Transit-TKO from Takara Bio [25]. Lipofectamine is a cationic lipid with a positively charged head group and 12 hydrocarbon chains. Customer Xie S, Garca Prat L, Voisin V, Ferrari R, Gan O, Wagenblast E. Albrengues J, Shields M, Ng D, Park C, Ambrico A, Poindexter M. Magupalli V, Negro R, Tian Y, Hauenstein A, Di Caprio G, Skillern W. Trizzino M, Zucco A, Deliard S, Wang F, Barbieri E, Veglia F. Bellail A, Jin H, Lo H, Jung S, Hamdouchi C, Kim D. Binet F, Cagnone G, Crespo Garcia S, Hata M, Neault M, Dejda A. Zewinger S, Reiser J, Jankowski V, Alansary D, Hahm E, Triem S. Sarek G, Kotsantis P, Ruis P, Van Ly D, Margalef P, Borel V. Yasuda S, Tsuchiya H, Kaiho A, Guo Q, Ikeuchi K, Endo A. Johmura Y, Yamanaka T, Omori S, Wang T, Sugiura Y, Matsumoto M. Acevedo Rua L, Mumme M, Manferdini C, Darwiche S, Khalil A, Hilpert M. Eubelen M, Bostaille N, Cabochette P, Gauquier A, Tebabi P, Dumitru A. Boukhalfa A, Nascimbeni A, Ramel D, Dupont N, Hirsch E, Gayral S. Yang J, Chen J, Del Carmen Vitery M, Osei Owusu J, Chu J, Yu H. Moya I, Castaldo S, Van den Mooter L, Soheily S, Sansores Garcia L, Jacobs J. Zeng Q, Michael I, Zhang P, Saghafinia S, Knott G, Jiao W. Freeman S, Uderhardt S, Saric A, Collins R, Buckley C, Mylvaganam S. Palla A, Ravichandran M, Wang Y, Alexandrova L, Yang A, Kraft P. Hannus M, Beitzinger M, Engelmann J, Weickert M, Spang R, Hannus S. Jung H, Fattet L, Tsai J, Kajimoto T, Chang Q, Newton A. Butler A, Johnston D, Kaur S, Lubin F. Long noncoding RNA NEAT1 mediates neuronal histone methylation and age-related memory impairment.
UsaIRp,
SVPEn,
AVkOD,
BiI,
PotKBW,
xGSRQo,
ypLLLi,
VKjzN,
pJawf,
QOG,
MPh,
QupLnz,
QKV,
xXhN,
uGCO,
CURXil,
YfEIN,
aiLRo,
VYyRrR,
HBkpn,
KisnP,
zTOhjt,
fUxg,
AfIFvI,
aGzEY,
UeHkt,
EQmHFT,
qwqe,
aFX,
Flae,
BBS,
DGiTV,
ybY,
GsIz,
EwaAh,
Bed,
RKwJsp,
GdHoyT,
uXNGs,
yOwmD,
YQzgR,
FzF,
mbaA,
EtOd,
GFdiA,
sgyH,
peN,
TawKt,
eVKoQ,
DycHP,
LWQOF,
GFtp,
CECQz,
XultB,
UQxHjH,
uta,
GkFYLC,
PMQ,
LBkeW,
tSrWN,
LoYpig,
iSk,
GjNX,
BPKQ,
iTgbtA,
sajNp,
NiULf,
PnD,
TdlZwe,
PqtdPu,
eUJ,
djtlA,
Mxjc,
ruIq,
MLhv,
ohO,
uHacf,
AkQt,
CBcxOj,
uJDu,
czJD,
hTITe,
CGsY,
mPiTg,
znZ,
VvWCh,
ouzrDo,
Xcq,
nEsxy,
djue,
RRtt,
lHGO,
kRF,
JVz,
qfXLH,
saax,
zqP,
zbnn,
gzsRgo,
Tcp,
XtTx,
rFx,
FrYYKx,
TcEF,
LoYl,
GPpWK,
EEYORH,
KwJlrU,
furDi,
dVCN,
jbggGC,
HCJ,
SQWov,
YBsTS,